View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8855_high_16 (Length: 293)
Name: NF8855_high_16
Description: NF8855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8855_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 32844600 - 32844869
Alignment:
| Q |
1 |
tcaccttgaaaaccaataatattccattgttgatagtttctcatcccgccaatgtcttcatcggagcctaagtacgacaccccaccggccccaacataca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32844600 |
tcaccttgaaaaccaataatattccattgttgatagtttctcatcccgccaatgtcttcatcggagcctaagtacgacaccccaccggccccaacataca |
32844699 |
T |
|
| Q |
101 |
agaccccaccggctctagtagccttcaccctcaccgtcctcatcttatgctttgtggctttcagcgtcgtgtatgtttgcaagtattgttttgctggcct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
32844700 |
agaccccaccggctctagtagccttcaccctcaccgtcctcatcttatgctttgtggctttcagcgttgtgtatgtttgcaagtattgttttgctggctt |
32844799 |
T |
|
| Q |
201 |
tttccacacttgggccttgcaacgcacgacctcaggttccctcgttcgtctctcacctgataggtcaccc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32844800 |
tttccacacttgggccttgcaacgcacgacctcaggttccctcgttcgtctctcacctgataggtcaccc |
32844869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 5 - 271
Target Start/End: Original strand, 27744924 - 27745190
Alignment:
| Q |
5 |
cttgaaaaccaataatattccattgttgatagtttctcatcccgccaatgtcttcatcggagcctaagtacgacaccccaccggccccaacatacaagac |
104 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||| || ||||||||| ||| || ||||||||||| |||||||||| ||| || | ||||| |
|
|
| T |
27744924 |
cttgaaaaccaataacagtccattgttgatagtttctcaattcgacaatgtctttatcagaatctaagtacgaccccccaccggctccagcacataagac |
27745023 |
T |
|
| Q |
105 |
cccaccggctctagtagccttcaccctcaccgtcctcatcttatgctttgtggctttcagcgtcgtgtatgtttgcaagtattgttttgctggccttttc |
204 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| | |||||| ||||||||||||| ||||| ||| ||||| |
|
|
| T |
27745024 |
cccaccggcactagtagccttcaccctcaccgtcctcatcctatgctttgtggctttcagcattgtgtatctttgcaagtattgctttgcaggcattttc |
27745123 |
T |
|
| Q |
205 |
cacacttgggccttgcaacgcacgacctcaggttccctcgttcgtctctcacctgataggtcacccc |
271 |
Q |
| |
|
|| | ||||||||||| |||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27745124 |
catatgtgggccttgcatcgcacggcctcaggatccctcgttcgtctctcacctgataggtcacccc |
27745190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University