View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8855_high_18 (Length: 250)
Name: NF8855_high_18
Description: NF8855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8855_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 33163566 - 33163805
Alignment:
| Q |
1 |
tgtgttggtggttattttgcaggtactttctgaaggctggatatgctgttatctttttgcaccgtaggtaaatttcttatcatgtaatttatccttttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33163566 |
tgtgttggtggttattttgcaggtactttctgaaggctggatatgctgttatctttttgcaccgtaggtaaatttcttatcatgtaatttatccttttct |
33163665 |
T |
|
| Q |
101 |
cacgtttgatgtgttgatttaccaatgaataattatgcagggggagttaccagccattttgcagatccattcctgatgatcccttacttgaatgcttcga |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33163666 |
catgtttgatgtgttgatttaccaatgaataattatgcagggggagttaccagccattttgcagatccattcctgatgatcccttacttgaatgcttcga |
33163765 |
T |
|
| Q |
201 |
gccaaccaacgatttaaatattcaaggttttccatctctg |
240 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33163766 |
gctgaccaacgatttaaatattcaaggttttccatttctg |
33163805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 106 - 232
Target Start/End: Complemental strand, 46162427 - 46162302
Alignment:
| Q |
106 |
ttgatgtgttgatttaccaatgaataattatgcagggggagttaccagccattttgcagatccattcctgatgatcccttacttgaatgcttcgagccaa |
205 |
Q |
| |
|
|||||||||| ||| ||||||||||| ||||||||||| |||| ||||||||||||||||||| |||| || |||||||||||||||||||||||||| | |
|
|
| T |
46162427 |
ttgatgtgttaatt-accaatgaatatttatgcaggggaagtttccagccattttgcagatcccttcccgaggatcccttacttgaatgcttcgagccca |
46162329 |
T |
|
| Q |
206 |
ccaacgatttaaatattcaaggttttc |
232 |
Q |
| |
|
||||||| ||||| ||||||||||||| |
|
|
| T |
46162328 |
ccaacgacttaaacattcaaggttttc |
46162302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 7 - 77
Target Start/End: Complemental strand, 46162558 - 46162488
Alignment:
| Q |
7 |
ggtggttattttgcaggtactttctgaaggctggatatgctgttatctttttgcaccgtaggtaaatttct |
77 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||| |
|
|
| T |
46162558 |
ggtggttactttgcaggtactttctgaaggctggatatgctgttatctttctgtaccggaggtaaatttct |
46162488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University