View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8855_high_26 (Length: 239)
Name: NF8855_high_26
Description: NF8855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8855_high_26 |
 | |
|
| [»] scaffold0691 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 80 - 224
Target Start/End: Original strand, 11115462 - 11115606
Alignment:
| Q |
80 |
agaatgaatagtgaaaacgtcgggaattgtaaagataaataagagaatcattgtttgatcggaggaaaggtaccttcnnnnnnngaatctagctagacac |
179 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| ||| |||||||||||| |
|
|
| T |
11115462 |
agaaagaatagtgaaaaagtcgggaattgtaaagataaataagagaatcattatttgatcagaggaaaggtaccttcttcttttgaagctagctagacac |
11115561 |
T |
|
| Q |
180 |
cttagcattctcagttgctcaggactccctggaggatgagttaat |
224 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
11115562 |
cttagcattctcagttgttcaggactccttggaggatgagttaat |
11115606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 109 - 221
Target Start/End: Original strand, 2836328 - 2836440
Alignment:
| Q |
109 |
taaagataaataagagaatcattgtttgatcggaggaaaggtaccttcnnnnnnngaatctagctagacaccttagcattctcagttgctcaggactccc |
208 |
Q |
| |
|
|||||||||||||||||| ||||| |||| ||||| |||||||||| ||| || |||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
2836328 |
taaagataaataagagaagcattgcgcgatcagaggagaggtaccttcttgttttgaagcttgctagacaccatagcattctcaattgctcaggactcct |
2836427 |
T |
|
| Q |
209 |
tggaggatgagtt |
221 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
2836428 |
tggaggacgagtt |
2836440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 102 - 156
Target Start/End: Complemental strand, 2799782 - 2799728
Alignment:
| Q |
102 |
ggaattgtaaagataaataagagaatcattgtttgatcggaggaaaggtaccttc |
156 |
Q |
| |
|
|||||| |||||||||||||||||| ||||| ||||| |||||||||||||||| |
|
|
| T |
2799782 |
ggaattataaagataaataagagaagcattgcatgatcagaggaaaggtaccttc |
2799728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0691 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0691
Description:
Target: scaffold0691; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 93 - 155
Target Start/End: Original strand, 3860 - 3922
Alignment:
| Q |
93 |
aaaacgtcgggaattgtaaagataaataagagaatcattgtttgatcggaggaaaggtacctt |
155 |
Q |
| |
|
|||| ||| |||||||||||| ||||| |||||| | || | ||||||||||||||||||||| |
|
|
| T |
3860 |
aaaatgtcaggaattgtaaagttaaatgagagaagctttctgtgatcggaggaaaggtacctt |
3922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University