View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8855_high_27 (Length: 234)
Name: NF8855_high_27
Description: NF8855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8855_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 42087003 - 42086804
Alignment:
| Q |
18 |
aacacaaacacccatctcttcttccaacagcttacaattaaaaaactgctccgccgccatcggccacccaagaataggtacaccatgactcaatgattcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42087003 |
aacacaaacacccatctcttcttccaacagcttacaattaaaaaactgctccgccgccatcggccacccaagaataggtacaccatgactcaatgattcc |
42086904 |
T |
 |
| Q |
118 |
aacactgagttccaaccacaatgactcaaaaacgcagaaactgatccatgtgataatatctcaacttgtggtgcccaatcatttactattatacctctct |
217 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42086903 |
aacaccgagttccaaccacaatgactcaaaaacgcagaaactgatccatgtgacaatatctcaacttgtggtgcccaatcatttactattatacctctct |
42086804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 112 - 149
Target Start/End: Original strand, 24462261 - 24462298
Alignment:
| Q |
112 |
gattccaacactgagttccaaccacaatgactcaaaaa |
149 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
24462261 |
gattccaacactgagttccatccacaatgagtcaaaaa |
24462298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University