View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8855_low_22 (Length: 251)
Name: NF8855_low_22
Description: NF8855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8855_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 3 - 233
Target Start/End: Complemental strand, 45614832 - 45614602
Alignment:
| Q |
3 |
gatggtctcttctccaccacttcgatggcttcttccttgaattgcaaaaggtaagacattgcaaaagcaaacaatagcatgcaacatacgagaatcacaa |
102 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45614832 |
gatggtctgttctccaccacttcgatggcttcttccttgaattgcaaaaggtaagacattgcaaaagcaaacaatagcatgcaacatacgagaatcacaa |
45614733 |
T |
 |
| Q |
103 |
aagacaagacaagacattgcatttcttactatgagtaatgctagcaacacactcacttttattggttaaattcatgtgagtcccatcaaatttaatatgg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45614732 |
tagacaagacaagacattgcatttcttactatgagtaatgctagcaacacactcacttttattggttaaattcatgtgagtcccatcaaatttaatatgg |
45614633 |
T |
 |
| Q |
203 |
accgacggtgtgaattctagagtaacaaata |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45614632 |
accgacggtgtgaattctagagtaacaaata |
45614602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University