View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8855_low_28 (Length: 241)
Name: NF8855_low_28
Description: NF8855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8855_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 34398092 - 34398334
Alignment:
| Q |
1 |
tcaaggcattcctctattctcaacgaattcatttcactattctatctatcatttgttagttaaatgttgttactttttgcattggcaggtttggttgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34398092 |
tcaaggcattcctctattctcaacgaattcatttcactattctatctatcatttgttagttaaatgttgttactttttgcattggcaggtttggttgttg |
34398191 |
T |
 |
| Q |
101 |
gatcagttcggtgttctccacgatggaaaacaaccttatcctggtgccatttcaacatgtatg---------tatgttatta----------ttatggtt |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
34398192 |
gatcagttcggtgttctccacgatggaaaacaaccttatcctggtgctatttcaacatgtatgttttcatcctatcttattatgtcttatctttatggtt |
34398291 |
T |
 |
| Q |
182 |
ggtttctattgtccaaccacataagtatacatgatcctaaatt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34398292 |
ggtttctattgtccaaccacataagtatacatgatcctaaatt |
34398334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University