View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8856_low_2 (Length: 444)
Name: NF8856_low_2
Description: NF8856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8856_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 2e-71; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 222 - 427
Target Start/End: Original strand, 22562826 - 22563028
Alignment:
| Q |
222 |
ccgaaaacttcagccattatgccgaataaatgttctcaaaaacctgcaaaattacgcagcnnnnnnncgcaaactaagacagcaaaatgcacgcaacatc |
321 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||||||| ||||| |||||| ||||||||||| ||| ||||| || |
|
|
| T |
22562826 |
ccgaaaacttcagccattatgccgaagaaatgttctcaaaaacctacaaaattatgcagcaaaat---gcaaacggagacagcaaaacgcatgcaacgtc |
22562922 |
T |
|
| Q |
322 |
agcacccctctgcgactacacaaaaacctcattgttaagtaatgggactttgttaatgcgacttcgttaattttcttctgctaaactgattttcaaggtg |
421 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22562923 |
agcacccctccgcgactgcacaaaaacctcattgttaagtaatgggactttgttaatgcgacttcgttaattttcttctgctaaactgattttcaaggtg |
22563022 |
T |
|
| Q |
422 |
cgtcat |
427 |
Q |
| |
|
|||||| |
|
|
| T |
22563023 |
cgtcat |
22563028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 99 - 214
Target Start/End: Original strand, 22562649 - 22562764
Alignment:
| Q |
99 |
aatcgcctaaatttttattggcttcaacccaccaccacaagtgtttataggtgggctgcagaacaaaatagccgtgagggacaacaacaattaaaaaatc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| ||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
22562649 |
aatcgcctaaatttttattggcttcaacccaccaccgcaagtgtttataggcgggctgcagatcaaaatagccgccagggacaacaccaattaaaaaatc |
22562748 |
T |
|
| Q |
199 |
attcaagcagccgaga |
214 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
22562749 |
attcaagcagccgaga |
22562764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 14 - 68
Target Start/End: Original strand, 22562382 - 22562436
Alignment:
| Q |
14 |
ggacatcaacgcatgtcggacacggcggcacgcctagttctagaggtgtacgtaa |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22562382 |
ggacatcaacgcatgtcggacacggcggcacgcctagttctagaggtgtacgtaa |
22562436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University