View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8856_low_6 (Length: 273)
Name: NF8856_low_6
Description: NF8856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8856_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 113 - 228
Target Start/End: Original strand, 12061670 - 12061781
Alignment:
| Q |
113 |
ggatcagttcatatttatgtaacaatggtgaatgaccgacttaggtctatggtttaacctacgttgaatctatattagattatannnnnnnaataaagaa |
212 |
Q |
| |
|
||||||||||||| ||||||||||| | ||||| || |||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
12061670 |
ggatcagttcataattatgtaacaacgatgaataaca----taggtctatggtttaacctacgttgaatctatattaaattatatttttttaataaagaa |
12061765 |
T |
|
| Q |
213 |
ggttcaaacattttta |
228 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
12061766 |
ggttcaaacattttta |
12061781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 12061559 - 12061616
Alignment:
| Q |
1 |
ttattcgttatccgttagaaaagaggaattttaaaaatcgaattcaagttatagtgga |
58 |
Q |
| |
|
|||||||||| | |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12061559 |
ttattcgttaccggttataaaagaggaattttaaaaatcgaattcaagttatagtgga |
12061616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University