View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8856_low_8 (Length: 244)
Name: NF8856_low_8
Description: NF8856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8856_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 45841619 - 45841837
Alignment:
| Q |
18 |
gaattctcctcctgaacaatggcaatcccatacactcagcatatttgatgataatttgatgtccaacagtttgatacatgtagctatcgagttcgtcgac |
117 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45841619 |
gaattctcctcctaaataatggcaatcccatacactcagcatatttgatgataatttgatgtccaacagtttgatacatgtagctatcgagttcgtcgac |
45841718 |
T |
 |
| Q |
118 |
agaatcatcaaccggcatcagattcgccaacgcgacgatctgatggccgtattgaatacacttcatcatggcgtagcaactgtctttcccgccgctaacg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45841719 |
agaatcatcaaccggcatcagattcgccaacgcgacgatctgatggccgtattgaatacacttcatcatggcgtagcaactgtctttcccgccgctaaca |
45841818 |
T |
 |
| Q |
218 |
agtgcaaccaccttcatct |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
45841819 |
agtgcaaccaccttcatct |
45841837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University