View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8856_low_9 (Length: 243)
Name: NF8856_low_9
Description: NF8856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8856_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 2 - 224
Target Start/End: Complemental strand, 42791870 - 42791648
Alignment:
| Q |
2 |
gaacttcggactatcatgactatttctttaaaaattgaaggttaatttacattgattgatcaataaataatatcattagattaaacgagatataatgtaa |
101 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42791870 |
gaacttcggactatcataactatttttttaaaaattgaaggttaatttacattgattgatcaataaataatatcattagattaaacgagatataatgtaa |
42791771 |
T |
|
| Q |
102 |
cctattgatggaatgattaaaaacgcatttgtcaagaccttgtaattgtacatattacataaaacttccttgtaatgtgatacattttgttctcttatat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42791770 |
cctattgatggaatgattaaaaacgcatttgtcaacaccttataattgtacatattacataaaacttccttgtaatgtgatacattttgttctcttatat |
42791671 |
T |
|
| Q |
202 |
tcgaatgtttgttgtcttcgaat |
224 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42791670 |
tcgaatgtttgttgtcttcgaat |
42791648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University