View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8857_high_8 (Length: 203)
Name: NF8857_high_8
Description: NF8857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8857_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 6e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 18359653 - 18359482
Alignment:
| Q |
19 |
caattcccgcagtttcaatttatgtgggatagtttggtttcttcnnnnnnntattagagtttaattagatgcactatcgatttagtttagttttatacta |
118 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18359653 |
caattcccgcggtttcaatttatgtgggatagtttggtttcttcaaaaaaatattagagtttaattagatgcactatcgatttagtttagttttatacta |
18359554 |
T |
 |
| Q |
119 |
acattcaagagaacttatatgaccatataagttcactttataacttccttttaaaaataacagtatagtatt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
18359553 |
acattcaagagaacttatatgaccatataagttcactttataacttccttttaaaaataactgtataatatt |
18359482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 33 - 95
Target Start/End: Complemental strand, 18359807 - 18359745
Alignment:
| Q |
33 |
tcaatttatgtgggatagtttggtttcttcnnnnnnntattagagtttaattagatgcactat |
95 |
Q |
| |
|
||||| |||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
18359807 |
tcaatctatgtgggctagtttggtttcttcacaaaaatattagagtttaattagatgcactat |
18359745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University