View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8857_low_6 (Length: 412)
Name: NF8857_low_6
Description: NF8857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8857_low_6 |
 |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
| [»] scaffold0186 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 5e-72; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 173 - 397
Target Start/End: Original strand, 2504195 - 2504419
Alignment:
| Q |
173 |
ttgccatgtcataggtggtatgagggggtgtatggaattgatatgtccatctatctttttcctttaattaaaggatttgaatttagatgcagtctttttt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2504195 |
ttgccatgtcataggtggtatgagggggtgtatggaattggtatgtccatctatctttttcctttaattaaaggatttgaatttagatgcagtctttttt |
2504294 |
T |
 |
| Q |
273 |
gacannnnnnnnnnnnnnnnnnnnnnnnngtactagtgagtttgtcctcaaaatgtgaaaattggatctgggatctaccctaggcgtgtgagagtgagta |
372 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2504295 |
gacagaaaatggaaaagaaaaattgaaaagtactagtgagtttgtcctcaaaatgtgaaaattggatctgggatctagcctaggcgtgtgagagtgagta |
2504394 |
T |
 |
| Q |
373 |
attgttaatgttccccagttgttgt |
397 |
Q |
| |
|
||||||||||||||| ||||||||| |
|
|
| T |
2504395 |
attgttaatgttcccgagttgttgt |
2504419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 177 - 235
Target Start/End: Complemental strand, 2499307 - 2499249
Alignment:
| Q |
177 |
catgtcataggtggtatgagggggtgtatggaattgatatgtccatctatctttttcct |
235 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2499307 |
catgtcataggtggtatgaggaggtgtatggaattggtatgtccatctatctttttcct |
2499249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 196 - 234
Target Start/End: Complemental strand, 1080887 - 1080849
Alignment:
| Q |
196 |
gggggtgtatggaattgatatgtccatctatctttttcc |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1080887 |
gggggtgtatggaattggtatgtccatctatctttttcc |
1080849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 4e-20; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 173 - 235
Target Start/End: Complemental strand, 13810891 - 13810829
Alignment:
| Q |
173 |
ttgccatgtcataggtggtatgagggggtgtatggaattgatatgtccatctatctttttcct |
235 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
13810891 |
ttgccatgtcataggtggtataagggggtgtatggaattggtatgtccatgtatctttttcct |
13810829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 173 - 237
Target Start/End: Original strand, 12215990 - 12216056
Alignment:
| Q |
173 |
ttgccatgtcataggtggtatgagggg--gtgtatggaattgatatgtccatctatctttttccttt |
237 |
Q |
| |
|
||||||||||||||||| ||| ||||| ||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
12215990 |
ttgccatgtcataggtgatataagggggggtgtatggaattggtatgtccatgtatcttttcccttt |
12216056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 173 - 234
Target Start/End: Original strand, 116311 - 116372
Alignment:
| Q |
173 |
ttgccatgtcataggtggtatgagggggtgtatggaattgatatgtccatctatctttttcc |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
116311 |
ttgccatgtcataggtggtataagggggtgtatggaattggtatgtccatgtatctttttcc |
116372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 22042883 - 22042822
Alignment:
| Q |
173 |
ttgccatgtcataggtggtatgagggggtgtatggaattgatatgtccatctatctttttcc |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
22042883 |
ttgccatgtcataggtggtataagggggtgtatggaattggtatgtccatgtatctttttcc |
22042822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 44353262 - 44353201
Alignment:
| Q |
173 |
ttgccatgtcataggtggtatgagggggtgtatggaattgatatgtccatctatctttttcc |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
44353262 |
ttgccatgtcataggtggtataagggggtgtatggaattggtatgtccatgtatctttttcc |
44353201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 237
Target Start/End: Original strand, 9691799 - 9691863
Alignment:
| Q |
173 |
ttgccatgtcataggtggtatgagggggtgtatggaattgatatgtccatctatctttttccttt |
237 |
Q |
| |
|
|||||||||||||| |||||| ||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
9691799 |
ttgccatgtcatagatggtataaggggatgtatggaattggtatgtccatgtatctttttccttt |
9691863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 173 - 228
Target Start/End: Original strand, 9806750 - 9806805
Alignment:
| Q |
173 |
ttgccatgtcataggtggtatgagggggtgtatggaattgatatgtccatctatct |
228 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
9806750 |
ttgccatgtcataggtggtatgagcgggtgtatggaattggtatgtccatgtatct |
9806805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 237
Target Start/End: Original strand, 13558176 - 13558240
Alignment:
| Q |
173 |
ttgccatgtcataggtggtatgagggggtgtatggaattgatatgtccatctatctttttccttt |
237 |
Q |
| |
|
|||||||||||||| |||||| ||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
13558176 |
ttgccatgtcatagatggtataaggggatgtatggaattggtatgtccatgtatctttttccttt |
13558240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0186 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0186
Description:
Target: scaffold0186; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 173 - 238
Target Start/End: Original strand, 31296 - 31361
Alignment:
| Q |
173 |
ttgccatgtcataggtggtatgagggggtgtatggaattgatatgtccatctatctttttccttta |
238 |
Q |
| |
|
||||||||||||||| ||||| | |||||||||| ||||| ||||||||| ||||||||||||||| |
|
|
| T |
31296 |
ttgccatgtcataggcggtataaaggggtgtatgaaattggtatgtccatgtatctttttccttta |
31361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University