View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8858_high_8 (Length: 254)
Name: NF8858_high_8
Description: NF8858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8858_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 27 - 236
Target Start/End: Complemental strand, 46355800 - 46355591
Alignment:
| Q |
27 |
accattgatcaaggttttaaggaactttatttaaaatcttgccgttgatatactttgtgtattattggtcatccaatatgatgaactacggtcaaacggc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46355800 |
accattgatcaaggttttaaggaactttatttaaaatcttgccgttgatatactttgtgtattattggtcatccaatatgatgaactacggtcaaacggc |
46355701 |
T |
 |
| Q |
127 |
tataaaacagaaacaaggcatcttaagtaaattttccaaagatgggatattgaacttctattggtccaagttttccacattaattgtcactttctaattg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46355700 |
tataaaacagaaacaaggcatcttaagtaaattttccaaagatgggatattgaacttctattggtccaagttttccacattaattgtcactttctaattg |
46355601 |
T |
 |
| Q |
227 |
accaacgatc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
46355600 |
accaacgatc |
46355591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University