View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8858_low_10 (Length: 269)

Name: NF8858_low_10
Description: NF8858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8858_low_10
NF8858_low_10
[»] chr8 (1 HSPs)
chr8 (134-251)||(30936527-30936644)


Alignment Details
Target: chr8 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 134 - 251
Target Start/End: Complemental strand, 30936644 - 30936527
Alignment:
134 gatcaagattatgatttgttagaatgagtatagttacatgtttcgttatttgcgcatggcctcaagaataaagtttacacatgtaattctatttgtatat 233  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
30936644 gatcaagattatgatttgttagaatgagtatagttacatgtttcgttatttgcgcatggcctcaaggataaagtttacacatgtaattctatttgtatat 30936545  T
234 aaagaaagagcatttatg 251  Q
    ||||||||||||||||||    
30936544 aaagaaagagcatttatg 30936527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University