View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8858_low_10 (Length: 269)
Name: NF8858_low_10
Description: NF8858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8858_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 134 - 251
Target Start/End: Complemental strand, 30936644 - 30936527
Alignment:
| Q |
134 |
gatcaagattatgatttgttagaatgagtatagttacatgtttcgttatttgcgcatggcctcaagaataaagtttacacatgtaattctatttgtatat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30936644 |
gatcaagattatgatttgttagaatgagtatagttacatgtttcgttatttgcgcatggcctcaaggataaagtttacacatgtaattctatttgtatat |
30936545 |
T |
 |
| Q |
234 |
aaagaaagagcatttatg |
251 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30936544 |
aaagaaagagcatttatg |
30936527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University