View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8858_low_12 (Length: 251)

Name: NF8858_low_12
Description: NF8858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8858_low_12
NF8858_low_12
[»] chr5 (1 HSPs)
chr5 (200-251)||(6408107-6408158)
[»] chr6 (3 HSPs)
chr6 (158-242)||(4966789-4966873)
chr6 (12-94)||(9818870-9818953)
chr6 (158-202)||(9818727-9818771)
[»] chr3 (3 HSPs)
chr3 (158-214)||(40404534-40404590)
chr3 (158-249)||(9488741-9488829)
chr3 (158-233)||(23202749-23202821)
[»] chr4 (1 HSPs)
chr4 (169-250)||(7685986-7686064)


Alignment Details
Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 6408107 - 6408158
Alignment:
200 atactgcagatgattattgtgcccatggacattggcgaatgctcctgttttt 251  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
6408107 atactgcagatgattattgtgcccatggacattggcgaatgctcctgttttt 6408158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 49; Significance: 4e-19; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 158 - 242
Target Start/End: Complemental strand, 4966873 - 4966789
Alignment:
158 aattgcaggttgtgaaggatccctttgatgcatcttttggcaatactgcagatgattattgtgcccatggacattggcgaatgct 242  Q
    ||||||||||||||||||| || |||| |||| ||||||||||||||||||||||| |||||||| || |||||||  |||||||    
4966873 aattgcaggttgtgaaggagccatttgttgcaacttttggcaatactgcagatgatcattgtgcctatagacattgaggaatgct 4966789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 9818953 - 9818870
Alignment:
12 attattcttcctttcatcactgtacaatgt-tgctaatttcttctactgtataaaattcctgctgatggggttcatcttttatg 94  Q
    ||||||||||||||||||||| |||||| | ||  || |||||||| | |||||||||| ||||||||||||| | ||||||||    
9818953 attattcttcctttcatcactatacaatatctgtgaacttcttctagtttataaaattcttgctgatggggttaaccttttatg 9818870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 202
Target Start/End: Complemental strand, 9818771 - 9818727
Alignment:
158 aattgcaggttgtgaaggatccctttgatgcatcttttggcaata 202  Q
    ||||||||||||||||||| |||||||||||| ||||||| ||||    
9818771 aattgcaggttgtgaaggagccctttgatgcaacttttggtaata 9818727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 158 - 214
Target Start/End: Original strand, 40404534 - 40404590
Alignment:
158 aattgcaggttgtgaaggatccctttgatgcatcttttggcaatactgcagatgatt 214  Q
    |||| |||||||||||||| ||||| |||||| |||| |||||||||||||||||||    
40404534 aattccaggttgtgaaggaacccttagatgcaactttaggcaatactgcagatgatt 40404590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 249
Target Start/End: Original strand, 9488741 - 9488829
Alignment:
158 aattgcaggttgtgaaggatccctttgatgcatcttttggcaatactgcagatgattattgtgcccatggacattggcgaatgctcctgttt 249  Q
    ||||| ||||||||||||| ||||||| |||| |||||||||||  ||||||||   ||||||||||| |||| ||| ||||| | ||||||    
9488741 aattgtaggttgtgaaggagccctttggtgcaacttttggcaatgttgcagatg---attgtgcccatagacagtggggaatgtttctgttt 9488829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 233
Target Start/End: Complemental strand, 23202821 - 23202749
Alignment:
158 aattgcaggttgtgaaggatccctttgatgcatcttttggcaatactgcagatgattattgtgcccatggacattg 233  Q
    ||||| |||||||||| || ||||||| |||| ||||||||||||||| |||||   ||||||||||| |||||||    
23202821 aattgtaggttgtgaacgagccctttggtgcaacttttggcaatactgaagatg---attgtgcccatagacattg 23202749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 250
Target Start/End: Complemental strand, 7686064 - 7685986
Alignment:
169 gtgaaggatccctttgatgcatcttttggcaatactgcagatgattattgtgcccatggacattggcgaatgctcctgtttt 250  Q
    |||||||| ||||||| |||| ||||||| |||||||||   ||| ||||||||||||||||| || ||||||| |||||||    
7686064 gtgaaggagccctttggtgcaacttttggaaatactgca---gatcattgtgcccatggacatcggggaatgcttctgtttt 7685986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University