View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8859_5 (Length: 485)
Name: NF8859_5
Description: NF8859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8859_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 115 - 456
Target Start/End: Complemental strand, 53679605 - 53679263
Alignment:
| Q |
115 |
acctgcttaatcaacattgaatcacctttcttactttcgtttgattttcttgaaaatccatccatttagatcagaaatagaacctaattgaattgatttt |
214 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53679605 |
acctgcttaatcaacaccgaatcacctttcttactttcgtttgattttcttgaaaatccatccatttagatcagaaatagaacctaattgaattgatttt |
53679506 |
T |
 |
| Q |
215 |
acatgcttaatcaactcccttcatgattcttgaattgtttgattgaaagattggtaaaaagtttcaattttgttcaccacgtttaacgttttaaatatgt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
53679505 |
acatgcttaatcaactcccttcatgattcttgaattgtttgattgaaagattggtaaaaaatttcaattttgttcaccatgtttaacgttttaaatatgt |
53679406 |
T |
 |
| Q |
315 |
catgtttcagttctgtttttaagctagttatattctggttcaa-ttcacttcttgttaaaacagttcagttagtaaccagaccttttcatatggttcagt |
413 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53679405 |
tatgtttcagttttgtttttaagctagttatattctggttcaatttcagttcttgttaaaacagttcagttagtaaccagaccttttcatatggttcagt |
53679306 |
T |
 |
| Q |
414 |
ctgaacatttataaaccagtttagtttaataacagtttggttc |
456 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53679305 |
ctgaacatttataaaccagtttagttcaataacagtttggttc |
53679263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 369 - 413
Target Start/End: Original strand, 2045022 - 2045066
Alignment:
| Q |
369 |
ttaaaacagttcagttagtaaccagaccttttcatatggttcagt |
413 |
Q |
| |
|
|||||||||||||| || |||||| ||||||||||||||||||| |
|
|
| T |
2045022 |
ttaaaacagttcagctaataaccaatccttttcatatggttcagt |
2045066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University