View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8860_low_16 (Length: 242)
Name: NF8860_low_16
Description: NF8860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8860_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 43725471 - 43725706
Alignment:
| Q |
1 |
ctttcctgcgaaaccaaacactgtaacttacttccaaattcttcttgtagcgatgatggttattgtagatacaatattacctacaaagacggtacaaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43725471 |
ctttcctgcgaaaccaaacactgtaacttacttccaaattcttcttgtagcgatgatggttattgtagatacaatattacctacaaagacggtacaaata |
43725570 |
T |
 |
| Q |
101 |
ccgaaggtgttttaataaatgaaacggtgtcgtttgaaagctctggatgggtggatagggtttcattaggttgcagtaataaaaaccaaggtccatttgt |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43725571 |
ctgaaggtgttttaataaatgaaacggtgtcgtttgaaagctctggatgggtggatagggtttcattaggttgcagtaataaaaaccaaggtccatttgt |
43725670 |
T |
 |
| Q |
201 |
agggtctgacggaacatttgggttaggtcgtgggtc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
43725671 |
agggtctgacggaacatttgggttaggtcgtgggtc |
43725706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University