View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8860_low_21 (Length: 222)
Name: NF8860_low_21
Description: NF8860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8860_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 34316797 - 34316596
Alignment:
| Q |
1 |
tttactctatgtctctttaaattatgatattatttgtcattttgtcttcattattttttatatgacccataatcatattaactttaagaggtgatgttcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34316797 |
tttactctatgtctctttaaattatgatattatttgtcattttgtcttcattattttttatatgacccataatcatattaactctaagaggtgatgttcc |
34316698 |
T |
|
| Q |
101 |
acaaatcattctcaatacttttatagaaactacctttacacgtaannnnnnnnngggaggtaagtggtaagttgtaaccttcacacattaattgatagag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34316697 |
acaaatcattctcaatacttttatagaaactacctttacacgtaatttttttttgggaggtaagtg-------gtaaccttcacacattaattgatagag |
34316605 |
T |
|
| Q |
201 |
ttgttgttg |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
34316604 |
ttgttgttg |
34316596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 13 - 63
Target Start/End: Original strand, 34314953 - 34315003
Alignment:
| Q |
13 |
ctctttaaattatgatattatttgtcattttgtcttcattattttttatat |
63 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34314953 |
ctctttgaattatgatattatttgtcgttttgtcttcattattttttatat |
34315003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University