View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8860_low_5 (Length: 424)
Name: NF8860_low_5
Description: NF8860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8860_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 283; Significance: 1e-158; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 121 - 411
Target Start/End: Complemental strand, 35720571 - 35720281
Alignment:
| Q |
121 |
ataactatcatcattgccccgttttggttttgattcacaatcatcaccaacactgtccttcattatatctttatgattctccaaagcacccgcattttgt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
35720571 |
ataactatcatcattgccccgttttggttttgattcacaatcatcaccaacactgtccttcattatatctttatgattctctaaagcactcgcattttgt |
35720472 |
T |
 |
| Q |
221 |
tgccgaattgcagcaaacgtgttttccagtctgtcacgtacaaaatcttccactttcatcgcctcacttttacgaccacgccttggcttccttggaattg |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35720471 |
tgccgaattgcagcaaacgtgttttccagtctgtcacgtacaaaatcttccactttcatcgcctcacttttacgaccacgccttggcttccttggaattg |
35720372 |
T |
 |
| Q |
321 |
ttgttggaaattcatcctcagaatttctatcatctttattaatggatacaccatctccactttggaaaattttccccttgttttttggtct |
411 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35720371 |
ttgttggaaattcatcctcagaatttctatcatctttattaatggatacaccatctccactttggaaaattttccccttgttttttggtct |
35720281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 52
Target Start/End: Complemental strand, 35720674 - 35720640
Alignment:
| Q |
18 |
ttattccccacccgacatctgtatctaatggccag |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35720674 |
ttattccccacccgacatctgtatctaatggccag |
35720640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University