View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8860_low_9 (Length: 325)
Name: NF8860_low_9
Description: NF8860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8860_low_9 |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0009 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 26 - 312
Target Start/End: Complemental strand, 5520 - 5225
Alignment:
| Q |
26 |
actccatggaaagatttcatagtcatagattgttcgagaattgctcctgcaaactatacatttgaaaa-tattagtat--------caaaatcaatgttg |
116 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
5520 |
actccatggaaagatgtcatagtcatagattgttcaagaattgctcctgcaaactatacatttgaaaaatattagtataactatttcaaaatcaatgttg |
5421 |
T |
 |
| Q |
117 |
gtgcaataaatcaagaaaatatactaaattcaaggaaaaaacggtatcaaatacattacattagtgctcgtgactttctccaactgtacaaaatcctctt |
216 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5420 |
gtgcaataaatcaagaaaagatattaaattcaaggaaaaaagggtatcaaatacattacattagtgctcgtgactttctccaactgtgcaaaatcctctt |
5321 |
T |
 |
| Q |
217 |
gagcaaaattagtgctcgtgactttcactaaacaaaagaaaaagaaaataatattgatcattttcaagactcacttctcaaacaattagagtatta |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5320 |
gagcaaaattagtgctcgtgactttcactaaacaaaagaaaaagaaaataatactaatcattttcgagactcacttctcaaacaattagagtatta |
5225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University