View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8861_high_15 (Length: 239)
Name: NF8861_high_15
Description: NF8861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8861_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 6 - 220
Target Start/End: Complemental strand, 46440339 - 46440125
Alignment:
| Q |
6 |
gggtagattatacttataatagtgataatgatgatgattatagtaattcagttcaattttagtgataacagttgtggtattggtgattcgtttaacgatc |
105 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46440339 |
gggtagattatagttataatagtgataatgatgatgattatagtaattcagttcaattttagtgataacagttgtggtattggtgattcgtttaacgatc |
46440240 |
T |
 |
| Q |
106 |
atggaaaattatatacgagaaattaaggtggcagagtacagcggcgtacccttgccggagttagatcgggcggcgaaggtgttatgcttccgaagcttgc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46440239 |
atggaaaattatatacgagaaattaaggtggcagagtacagcggcgtacccttgccggagttagatcgggcggcgaaggtgttatgcttccgaagcttgc |
46440140 |
T |
 |
| Q |
206 |
cgagaccgttctccg |
220 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
46440139 |
tgagaccgttctccg |
46440125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University