View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8861_high_22 (Length: 213)
Name: NF8861_high_22
Description: NF8861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8861_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 46845192 - 46845011
Alignment:
| Q |
17 |
gtggtaaaggaggccgtggtttatgccccgagagtgggt-ggacactaactacttgcaacgatgctaaatagaaattaacaccaatggtaagtaactaaa |
115 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46845192 |
gtggtaaagaaggccatggtttatgccccgagagtgggttggacactcactacttgcaacgatgctaaatagaaattaacaccaatggtaagtaactaaa |
46845093 |
T |
 |
| Q |
116 |
ttttacaatg-aaaacaagtttcactgttttcatctcaaagaaaacaaagaacatccaaattcattccactgaactggtaaa |
196 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46845092 |
ttttacaatgaaaaacaagtttcacttttttcatctcaaagaaaacaaagaacatacaaattcattccactgaactggtaaa |
46845011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University