View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8861_low_12 (Length: 352)
Name: NF8861_low_12
Description: NF8861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8861_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 10 - 245
Target Start/End: Complemental strand, 11347700 - 11347464
Alignment:
| Q |
10 |
cttcagatgtttgatagcgggtaaaagtgttcaacgcacaaacacctaatggatatgatgcatatatgagacatgtaaggtagtgtatttcagcgattcc |
109 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| |||||| || || |||| |||||||||||||| |||||||||||| |||||||||| ||||| |
|
|
| T |
11347700 |
cttcagatgtttgatagcggacagaagtgttcaacgaacaaacgcccaacagataggatgcatatatgaggcatgtaaggtagcgtatttcagcaattcc |
11347601 |
T |
|
| Q |
110 |
aacttgtgaaaaatgccctatgaaatggtctcaggcgcgacgtgtgtcaagaaatgaagttcttcaaatgcaact-atgtaattccgcgacgcggctaag |
208 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
11347600 |
aactcgtgtaaaatgccctatgaaatggtctcaggcgcgaggtgtgtcaagaaatgaagttcttcaaatgcaactcatgtaattccgcgaggcggctaag |
11347501 |
T |
|
| Q |
209 |
gcaaagacttatagtttactttctgcaaattttcctt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11347500 |
gcaaagacttatagtttactttctgcaaattttcctt |
11347464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University