View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8861_low_26 (Length: 238)
Name: NF8861_low_26
Description: NF8861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8861_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 49 - 220
Target Start/End: Original strand, 36529840 - 36530011
Alignment:
| Q |
49 |
caggttcttagttttgtacatttacatgtcctatagtatattcacttgccaatgttgttgatggaatggtaacattgtagtcagggaacaggacaaccct |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36529840 |
caggttcttagttttgtacatttacatgtcctatagtatattcacttgccaatgttgttgatggaatggtaacattgtagtcagggaacaggacaaccct |
36529939 |
T |
 |
| Q |
149 |
ctgcatgtacacctggagctgtagggcatttagccaaagggcagtggtctggttcaagaccccaccaagttg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36529940 |
ctgcatgtacacctggagctgtagggcatttagccaaagggcagtggtctggttcaagaccccaccaagttg |
36530011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 86 - 220
Target Start/End: Original strand, 36535489 - 36535623
Alignment:
| Q |
86 |
atattcacttgccaatgttgttgatggaatggtaacattgtagtcagggaacaggacaaccctctgcatgtacacctggagctgtagggcatttagccaa |
185 |
Q |
| |
|
||||||| ||| |||| ||| |||||||||| || ||| | ||||||||||||||||||||||| || | |||||||||||||||||| ||| ||||||| |
|
|
| T |
36535489 |
atattcatttggcaatattgctgatggaatgttatcatggaagtcagggaacaggacaaccctcagcgtatacacctggagctgtaggacatctagccaa |
36535588 |
T |
 |
| Q |
186 |
agggcagtggtctggttcaagaccccaccaagttg |
220 |
Q |
| |
|
||||||||| |||| |||||| |||||||| |||| |
|
|
| T |
36535589 |
agggcagtgatctgcttcaaggccccaccatgttg |
36535623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 108 - 220
Target Start/End: Original strand, 36523066 - 36523178
Alignment:
| Q |
108 |
gatggaatggtaacattgtagtcagggaacaggacaaccctctgcatgtacacctggagctgtagggcatttagccaaagggcagtggtctggttcaaga |
207 |
Q |
| |
|
||||||||||| |||| | ||||| ||||| ||||||||||||||||||||||||||| |||||| ||| |||| |||||||| || |||| ||||||| |
|
|
| T |
36523066 |
gatggaatggttacatggaagtcaaagaacatgacaaccctctgcatgtacacctggagatgtaggacatctagctaaagggcaatgatctgcttcaaga |
36523165 |
T |
 |
| Q |
208 |
ccccaccaagttg |
220 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36523166 |
ccccaccaagttg |
36523178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University