View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8862_high_11 (Length: 297)
Name: NF8862_high_11
Description: NF8862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8862_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 2 - 273
Target Start/End: Original strand, 35266301 - 35266572
Alignment:
| Q |
2 |
tcggttcctctttctcaagtgctacgtctctccgatacaatcggtaaccgtcacttgttcgtagacttcgctccattccgccgtaataccaagcggtgca |
101 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35266301 |
tcggtttctctttctcaagtgctacgtctctccgatacaatcggtaaccgtcacttgttcgtagacttcgctccattccgccgtaataccaagcggtgca |
35266400 |
T |
 |
| Q |
102 |
accgtagattgacgccggcgattctccgtcggagctccgttaaagctgttcttcaacttgataataatcatctcaatcctgctcctcctccttcttcgcc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35266401 |
accgtagattgacgccggcgattctccgtcggagctccgttaaagctgttcttcaacttgataataatcatctcaatcctgctcctcctccttcttcgcc |
35266500 |
T |
 |
| Q |
202 |
gtcaacttccgattccaaacccaaggtccggtttcttcatccgttgctatttttgcacaaccatttcgtaat |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35266501 |
gtcaacttccgattccaaacccaaggtccggtttcttcatccgttgctatttttgcacaacgatttcgtaat |
35266572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University