View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8862_high_12 (Length: 282)
Name: NF8862_high_12
Description: NF8862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8862_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 20 - 278
Target Start/End: Original strand, 54958618 - 54958876
Alignment:
| Q |
20 |
aatgcctacacaggtaaagcagaaacactcgactacacatcgacgaaaggagccattgttgcattcactagaggtcttgctcagcagttggtgagaaagg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54958618 |
aatgcctacacaggtaaagcagaaacactcgactacacatcgacgaaaggagccattgttgcattcactagaggtcttgctcagcagttggtgagcaagg |
54958717 |
T |
 |
| Q |
120 |
gaataagagtgaatggtgttgcaccaggaccaatttggacgccagttcaaccagctactatgacttatgagaagatacagaatttggggtcagatgtgcc |
219 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54958718 |
gaataagagtgaatgctgttgctccaggaccaatttggacgccagttcaaccagctactatgccttatgagaagatacagaatttggggtcagatgtgcc |
54958817 |
T |
 |
| Q |
220 |
aatgaaacgagcaggtcagccttgtgagattgcaccttgttatttgttctctgcttctc |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
54958818 |
aatgaaacgagcaggtcagccttgtgagattgcaccttgttatttattcttggcttctc |
54958876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University