View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8862_high_13 (Length: 279)
Name: NF8862_high_13
Description: NF8862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8862_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 31869907 - 31869639
Alignment:
| Q |
1 |
atataacagagaattgcactcaaatgtgaccgatgctatctcaattatagtcacagtaacaacaaaaaccctgatgttgctgcccagatctcagtcacag |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31869907 |
atataacagagaattgcactcaaatgcgaccgatgctatctcaattatagtcacagtaacaacaaaaaccctgatgttgctgcccagatctcagtcacaa |
31869808 |
T |
 |
| Q |
101 |
acttctgtttaaaacctttgcagctgcattacatgatgcaatctaaaggtctgctggcaaatgtagtgtaacctttacactgccatttaaaacatcgnnn |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31869807 |
acttctgtttaaaacctttgcagctgcattacatgatgcaatctaaaagtctgctggcaaatgtagtgtaacctttacactgccatttaaaacatcgaaa |
31869708 |
T |
 |
| Q |
201 |
nnnnttattttttgaagtcgatgtttgtggttgagaattattaacactcaaatatcttgctggtctgtg |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31869707 |
aaaattattttttgaagtcgatgtttgtggttgagaattattaacactcaaatatcttgctggtctgtg |
31869639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University