View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8862_low_16 (Length: 232)
Name: NF8862_low_16
Description: NF8862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8862_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 35266084 - 35266202
Alignment:
| Q |
1 |
acatcaaacaaaaacccagtgagactagcactttcacaagttcaagatgaagattgaaaaggaatgagaagttggtggtgtatatgaattaagtactttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35266084 |
acatcaaacaaaaacccagtgagactagcactttcacaagttcaagatgaagattgaaaaggaatgagaagttggtggtgtatatgaattaagtactttg |
35266183 |
T |
 |
| Q |
101 |
tgacctcttcttcctttta |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
35266184 |
tgacctcttcttcctttta |
35266202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 188 - 232
Target Start/End: Original strand, 35266275 - 35266319
Alignment:
| Q |
188 |
gggcgatggcgctgaacacggtgtcatcggtttctctttctcaag |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35266275 |
gggcgatggcgctgaacacggtgtcatcggtttctctttctcaag |
35266319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University