View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8863_low_12 (Length: 203)

Name: NF8863_low_12
Description: NF8863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8863_low_12
NF8863_low_12
[»] chr3 (1 HSPs)
chr3 (20-193)||(47708025-47708198)


Alignment Details
Target: chr3 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 20 - 193
Target Start/End: Original strand, 47708025 - 47708198
Alignment:
20 gttagtattgagattgctgatgcaattttggaatgtgtgatcagggatgaagtagtatcagatatcattgaaattttatcacgcaacaaaattaatttct 119  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
47708025 gttagtattgagattgctgatgcaattttggaatgtgtgattagggatgaagtagtatcagatatcattgaaattttatcacacaacaaaattaatttct 47708124  T
120 gttgttgtaagtaatatctcctgtccataagccattgcttcttaaatgatgggttgcttgctctctctgcttct 193  Q
    |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |||||    
47708125 gttgttgtaagtaatatctcatgtcaataagccattgcttcttaaatgatgggttgcttgctctctctacttct 47708198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University