View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8863_low_12 (Length: 203)
Name: NF8863_low_12
Description: NF8863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8863_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 20 - 193
Target Start/End: Original strand, 47708025 - 47708198
Alignment:
| Q |
20 |
gttagtattgagattgctgatgcaattttggaatgtgtgatcagggatgaagtagtatcagatatcattgaaattttatcacgcaacaaaattaatttct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47708025 |
gttagtattgagattgctgatgcaattttggaatgtgtgattagggatgaagtagtatcagatatcattgaaattttatcacacaacaaaattaatttct |
47708124 |
T |
 |
| Q |
120 |
gttgttgtaagtaatatctcctgtccataagccattgcttcttaaatgatgggttgcttgctctctctgcttct |
193 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47708125 |
gttgttgtaagtaatatctcatgtcaataagccattgcttcttaaatgatgggttgcttgctctctctacttct |
47708198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University