View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8864_high_9 (Length: 249)
Name: NF8864_high_9
Description: NF8864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8864_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 16 - 219
Target Start/End: Original strand, 50549738 - 50549952
Alignment:
| Q |
16 |
attattctttaaaaccattacttgttccttcataacctttttcccactatttggtttat---tgttgtcgtcagtcatagaaggagaaacttcattgagg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50549738 |
attattctttaaaaccattacttgttccttcataacctttttcccactatttggtttattattgttgtcgtcagtcatagaaggagaaacttcattgagg |
50549837 |
T |
 |
| Q |
113 |
ttctttatggggtcttcacgtatctttcttttc----nnnnnnnccttatcccatggta----tatgcttcccacttgaactatttgaccctacatgaaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
50549838 |
ttctttatggggtcttcacgtatctttcttttcttttcttttttccttatcccatggtatatgtatgcttcccacttgaaatatttcaccctacatgaaa |
50549937 |
T |
 |
| Q |
205 |
ggttaattggtcctt |
219 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
50549938 |
ggtcaattggtcctt |
50549952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University