View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8864_low_14 (Length: 240)
Name: NF8864_low_14
Description: NF8864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8864_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 22 - 239
Target Start/End: Original strand, 2181849 - 2182066
Alignment:
| Q |
22 |
ctataatgtaaccaaaatttaagtaactcttgatatttagaatctccaacacacgtgaaattattagaagattgtaattttctctcttcaaaatacaaga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |||||||||||||||||| |||||| ||||||| |
|
|
| T |
2181849 |
ctataatgtaaccaaaatttaagtaactctggatatttagaatctccgacacacgtgaaattattataagattgtaattttctctattcaaattacaaga |
2181948 |
T |
|
| Q |
122 |
tattactagcttgcacaggaaccctattgcaaattgctatgatttctttgagatagtgatattgacgttataatgaatgaattgacacataagataagat |
221 |
Q |
| |
|
||||||||||||||||| ||| ||||||| |||||| |||||||||||||||||| |||||||| ||||||| |||||| ||| ||||||||||||||| |
|
|
| T |
2181949 |
tattactagcttgcacaagaatcctattgaaaattgtcatgatttctttgagatagagatattgatgttataacgaatgagttgtcacataagataagat |
2182048 |
T |
|
| Q |
222 |
agggataagaatgaaagt |
239 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2182049 |
agggataagaatgaaagt |
2182066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University