View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8864_low_9 (Length: 271)
Name: NF8864_low_9
Description: NF8864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8864_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 22 - 263
Target Start/End: Complemental strand, 34929909 - 34929668
Alignment:
| Q |
22 |
cataatcataagtagtataataatttaatgccatggggcagggcatgtgaaacacgatgaaatggtatttaannnnnnnnaatatccactataattcaga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34929909 |
cataatcataagtagtataataatttaatgccatggggcagggcatgtgaaacacgatgaaatggtatttaattttttttaatatccactataattcaga |
34929810 |
T |
|
| Q |
122 |
aatatattctatatatactccattatagatgcttggtggtttcaactttcaagactcgtggagtcatggcctcagcatgtgctagctctttctttcaatt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34929809 |
aatatattctatatatactccattatagatgcttggtggtttcaactttcaagactcgtggagtcatggcctcagcatgtgctagctctttctttcaatt |
34929710 |
T |
|
| Q |
222 |
cctttctataacccttctactagttacactctcttctctgct |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34929709 |
cctttctataacccttctactagttacactctcttctatgct |
34929668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 185 - 263
Target Start/End: Complemental strand, 34933840 - 34933762
Alignment:
| Q |
185 |
tcatggcctcagcatgtgctagctctttctttcaattcctttctataacccttctactagttacactctcttctctgct |
263 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||| | | |||| |||||||||||| ||||| |||| |
|
|
| T |
34933840 |
tcatggactcagcatgtgctagctctttctttcaattcctctctatgatcgttcttctagttacactcccttctatgct |
34933762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University