View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8865_high_11 (Length: 250)

Name: NF8865_high_11
Description: NF8865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8865_high_11
NF8865_high_11
[»] chr4 (1 HSPs)
chr4 (14-231)||(41980734-41980951)


Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 14 - 231
Target Start/End: Complemental strand, 41980951 - 41980734
Alignment:
14 agagaacagccattagaacaactggtataatccaatccattcaatccaaaataaatatatttaacccattagaacaaggcataagatggcaataatatca 113  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41980951 agagaacaaccattagaacaactggtataatccaatccattcaatccaaaataaatatatttaacccattagaacaaggcataagatggcaataatatca 41980852  T
114 tgatatgtaggacaatatcccaaaattctacagaatccaattgctcccaattcccattcataataacttactaaaaagtcgctnnnnnnncttataagaa 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||    
41980851 tgatatgtaggacaatatcccaaaattctacagaatccaattgctcccaattcccattcataataacttactaaaaagtcgctaaaaaaacttataagaa 41980752  T
214 gaaatgaaaccggaggaa 231  Q
    ||||||||||||||||||    
41980751 gaaatgaaaccggaggaa 41980734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University