View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8865_low_14 (Length: 288)
Name: NF8865_low_14
Description: NF8865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8865_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 12 - 201
Target Start/End: Original strand, 48534474 - 48534663
Alignment:
| Q |
12 |
atgaaacaaatctgtcatgtatttcttctgtacaagcagctgagccttgggattgttatagatttctggaagatatgcctcaccagcaccatttctatgc |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| || ||| | | ||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48534474 |
atgaaataaatctgtcatgtatttcttctgtacaagtagttgaacatcaggattgttatagattcctggaagatatgcctcaccagcaccatttttatgc |
48534573 |
T |
 |
| Q |
112 |
ttattccaaagtgcagtgaatttatagtggaaaagattccaagtgttttcaattgtcttaagaatccactctttatatgtctgcataaca |
201 |
Q |
| |
|
| || |||||||||||||||||||| |||||||||||||||||||| | ||||||||||||||||||| || ||||||| |||||||||| |
|
|
| T |
48534574 |
tcatcccaaagtgcagtgaatttatggtggaaaagattccaagtgtctgcaattgtcttaagaatccattccttatatgcctgcataaca |
48534663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University