View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8865_low_17 (Length: 241)

Name: NF8865_low_17
Description: NF8865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8865_low_17
NF8865_low_17
[»] chr2 (1 HSPs)
chr2 (7-44)||(1079408-1079445)


Alignment Details
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 44
Target Start/End: Complemental strand, 1079445 - 1079408
Alignment:
7 catctagtaatcagtttcataaacatcttctatcatag 44  Q
    ||||||||||||||||||||||||||||||||||||||    
1079445 catctagtaatcagtttcataaacatcttctatcatag 1079408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University