View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8865_low_19 (Length: 224)
Name: NF8865_low_19
Description: NF8865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8865_low_19 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 3 - 224
Target Start/End: Original strand, 36583146 - 36583367
Alignment:
| Q |
3 |
agattatactgatctgaatcggtttcattgtaaagagtattgaaggattctttaccgttaagagaagagaaagtgaaaacggatttaacgagatcagatt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36583146 |
agattatactgatctgaatcggtttcattgtaaagagtattgaaggattctttaccgttaagagaagagaaagtgaaaacggatttaacgagatcggatt |
36583245 |
T |
|
| Q |
103 |
gaagagcgcaacgaatttcaccgtcttcaagttgttgaagaacgtgaagccatgaatcgagagtgcagaggaagaaaccgactttggagagatcgagatt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36583246 |
gaagagcgcaacgaatttcaccgtcttcgagttgttgaagaacgtgaagccatgaatcgagagtgcagaggaagaaaccgactttggagagatcgagatt |
36583345 |
T |
|
| Q |
203 |
ggagttagacagtgagattttg |
224 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
36583346 |
ggagttagagagtgagattttg |
36583367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University