View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8865_low_21 (Length: 214)
Name: NF8865_low_21
Description: NF8865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8865_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 165
Target Start/End: Complemental strand, 43316314 - 43316167
Alignment:
| Q |
18 |
ttctctagaataccaagatcgcgatgccaccacaaccgttatagctagcaacctctactagaaatccaacatatggctagcttggttaatttggattcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43316314 |
ttctctagaataccaagatcgcgatgccaccataaccgttatagctagcaacctctactagaaatccaacatatggctagcttggttaatttggattcaa |
43316215 |
T |
 |
| Q |
118 |
actagaaattatttgaaaaccaatataagtaataagttgtaagattag |
165 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43316214 |
actaaaaattatttgaaaaccaatataagtaataagttgtaagattag |
43316167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University