View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8866_high_6 (Length: 201)
Name: NF8866_high_6
Description: NF8866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8866_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 13 - 186
Target Start/End: Original strand, 32560587 - 32560760
Alignment:
| Q |
13 |
gcagagaggaagtggtagaaagtggacagttcaaagggatttggatcagttgagacagtataaaaatggttcttttgatgatatcgaggtgattaagatt |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32560587 |
gcagaaaggaagtggtagaaagtggacagttcaaagggatttggatcagttgagacagtataaaaatggttcttttgatgatattgaggtgattaagatt |
32560686 |
T |
 |
| Q |
113 |
gatgggaaaaaccctttcttgtggcatgatcattggcctgttaaggactatgcaaaggtttttgagtgcttagt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32560687 |
gatgggaaaaaccctttcttgtggcatgatcattggcctgttaaggactatgcaaaggtttttgagtgcttagt |
32560760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 116 - 183
Target Start/End: Original strand, 10751111 - 10751178
Alignment:
| Q |
116 |
gggaaaaaccctttcttgtggcatgatcattggcctgttaaggactatgcaaaggtttttgagtgctt |
183 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| | || |||||| |||||||||||||||||| |
|
|
| T |
10751111 |
gggaaaaaccctttcttatggcatgatcattggcctttgaaaaactatggaaaggtttttgagtgctt |
10751178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University