View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8866_low_6 (Length: 201)

Name: NF8866_low_6
Description: NF8866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8866_low_6
NF8866_low_6
[»] chr4 (1 HSPs)
chr4 (13-186)||(32560587-32560760)
[»] chr2 (1 HSPs)
chr2 (116-183)||(10751111-10751178)


Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 13 - 186
Target Start/End: Original strand, 32560587 - 32560760
Alignment:
13 gcagagaggaagtggtagaaagtggacagttcaaagggatttggatcagttgagacagtataaaaatggttcttttgatgatatcgaggtgattaagatt 112  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
32560587 gcagaaaggaagtggtagaaagtggacagttcaaagggatttggatcagttgagacagtataaaaatggttcttttgatgatattgaggtgattaagatt 32560686  T
113 gatgggaaaaaccctttcttgtggcatgatcattggcctgttaaggactatgcaaaggtttttgagtgcttagt 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32560687 gatgggaaaaaccctttcttgtggcatgatcattggcctgttaaggactatgcaaaggtttttgagtgcttagt 32560760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 116 - 183
Target Start/End: Original strand, 10751111 - 10751178
Alignment:
116 gggaaaaaccctttcttgtggcatgatcattggcctgttaaggactatgcaaaggtttttgagtgctt 183  Q
    ||||||||||||||||| |||||||||||||||||| | ||  |||||| ||||||||||||||||||    
10751111 gggaaaaaccctttcttatggcatgatcattggcctttgaaaaactatggaaaggtttttgagtgctt 10751178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University