View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8867_low_4 (Length: 225)
Name: NF8867_low_4
Description: NF8867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8867_low_4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 40122226 - 40122004
Alignment:
| Q |
1 |
cattcatcaacttatttaacgggacaccacaacttatcgatgtggatcaa--acaactaaacacattttcacaaacaaccaaatttcctatctaccatct |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40122226 |
cattcatcaacttatttaacgggacaccacaacttatcgatgtgtatcaacaacaactaaacacattttcataaacaaccaaatttcctatctaccatct |
40122127 |
T |
 |
| Q |
99 |
cttcagtacaattggatatataagacatattattcaatgtcaaaatgaaccaagtatcatagctactggatacaagtttaagataacagcaatctgcaat |
198 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40122126 |
cttcagtacaattggata----agacatattattcaatgtcaaaatgaaccaagtatcatagctgctggatataagtttaagataacagcaatctgcaat |
40122031 |
T |
 |
| Q |
199 |
atcagttaatgaatgtatagtcttttt |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40122030 |
atcagttaatgaatgtatagtcttttt |
40122004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University