View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8868_high_8 (Length: 229)

Name: NF8868_high_8
Description: NF8868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8868_high_8
NF8868_high_8
[»] chr2 (1 HSPs)
chr2 (20-110)||(33258176-33258265)


Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 20 - 110
Target Start/End: Complemental strand, 33258265 - 33258176
Alignment:
20 tgtctctctaacatgtttctatctcctcatttattaactttgatgatgtgtggtggtggcaaattctgatcaatttggataaactttagtc 110  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33258265 tgtctctcta-catgtttctatctcctcatttattaactttgatgatgtgtggtggtggcaaattctgatcaatttggataaactttagtc 33258176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University