View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8868_low_8 (Length: 229)
Name: NF8868_low_8
Description: NF8868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8868_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 20 - 110
Target Start/End: Complemental strand, 33258265 - 33258176
Alignment:
| Q |
20 |
tgtctctctaacatgtttctatctcctcatttattaactttgatgatgtgtggtggtggcaaattctgatcaatttggataaactttagtc |
110 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33258265 |
tgtctctcta-catgtttctatctcctcatttattaactttgatgatgtgtggtggtggcaaattctgatcaatttggataaactttagtc |
33258176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University