View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8869_high_8 (Length: 259)
Name: NF8869_high_8
Description: NF8869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8869_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 40642674 - 40642441
Alignment:
| Q |
18 |
attttagaggttactgcttgtgcagctattattagctgggttgtatgttgttattagacctacatgggaagataggcagacttggtcccttaattgaacg |
117 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40642674 |
attttagaggttactacttgtgcatctattattagctgggttgtgtgttgttattagacctacatgggaagataggcagacttggtcccttaattgaacg |
40642575 |
T |
 |
| Q |
118 |
ggaattttacagttaaatcttcttatttcttgatttctaaggagttgttgagtgtgacaaatcgacgcttgctaaagataaatgttaaattggatcctct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
40642574 |
ggaattttacagttaaatcttcttatttcttgatttttaaggagttgttgagtgtgacaaatcgaggcttgctaaagacaaatgttaaattggatcctct |
40642475 |
T |
 |
| Q |
218 |
cattcttcttcattcatcaaatcgtgttcatctc |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||| |
|
|
| T |
40642474 |
cattcttcttcattcaccaaatcgtgtttatctc |
40642441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University