View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8869_low_11 (Length: 245)
Name: NF8869_low_11
Description: NF8869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8869_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 231
Target Start/End: Original strand, 30114270 - 30114483
Alignment:
| Q |
19 |
aatcatacaataagaattatcaaggtataaaataaaaagattttgtcttcatttggtatttacatatctgcattcagatgcttacaatataaatggtgaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30114270 |
aatcatacaataagaattatcaaggtataaaataaaaagattttgtcttcatttggtatttacatatctgcattcagatgcttacaatataaatggtgaa |
30114369 |
T |
 |
| Q |
119 |
ttgc-attnnnnnnnctacaagagctgaaaatgaaattgctatttgctagtccccactagcgatagtgccatatcaattaccattaattcatgatgcctc |
217 |
Q |
| |
|
|||| || |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30114370 |
ttgcaataaaaaaaactacaagagctgaagatgaaattgctatttgctagtccccactagcgatagtgccatatcaattaccattaattcatgatgcctc |
30114469 |
T |
 |
| Q |
218 |
acctcaagaataat |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30114470 |
acctcaagaataat |
30114483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University