View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8869_low_12 (Length: 245)
Name: NF8869_low_12
Description: NF8869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8869_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 3 - 230
Target Start/End: Original strand, 47348941 - 47349166
Alignment:
| Q |
3 |
tttaaaaatttatctgccgttgaatctggtggatttttacagagtttgtttttgcgcattatcggtatacattatttaaaaaagcttttttgaagtactg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47348941 |
tttaaaaatttatctgccgttgaatctggtggatttttacag--tttgtttttgcgcattatcggtatacattatttaaaaaagcttttttgaagtactg |
47349038 |
T |
 |
| Q |
103 |
taagttgcacttgcaagataaaatagaatatcagtgttttacattgttttggtatgtgttcattgaaaccaatatctagctggtagaattagtagtttga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47349039 |
taagttgcacttgcaagataaaatagaatatcagtgttttacattgttttggtatgtgttcattgaaaccaatatctagctggtagaattagtagtttga |
47349138 |
T |
 |
| Q |
203 |
tttcactagcagacttaagttaaatttg |
230 |
Q |
| |
|
|||||||||||||||| ||||||||||| |
|
|
| T |
47349139 |
tttcactagcagacttgagttaaatttg |
47349166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University