View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8869_low_13 (Length: 242)
Name: NF8869_low_13
Description: NF8869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8869_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 20 - 157
Target Start/End: Original strand, 54803756 - 54803893
Alignment:
| Q |
20 |
agaaacttaatggccacgattgaattggcatatatatctttgcatgtaacgatatttcaattggaaggctgacaatgaattttggagaataatttgaaat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54803756 |
agaaacttaatggccacgattgaattggcatatatatctttgcatgtaacgatatttcaattggaaggctgacaatgaattttggagaataatttgaaat |
54803855 |
T |
|
| Q |
120 |
tttcaaccgggacaaggaattatgatatacatttttct |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54803856 |
tttcaaccgggacaaggaattatgatatacatttttct |
54803893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 205 - 242
Target Start/End: Original strand, 54803945 - 54803982
Alignment:
| Q |
205 |
cttaattgagagaatagatctttggtaatgcggagttt |
242 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54803945 |
cttaattgagagaaaagatctttggtaatgcggagttt |
54803982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University