View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8870_high_7 (Length: 232)
Name: NF8870_high_7
Description: NF8870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8870_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 16 - 216
Target Start/End: Complemental strand, 43376649 - 43376439
Alignment:
| Q |
16 |
aagaagtgacgtgtgtctgtgtggtggtgggccatagcattgcctatccgttattgctgatgaacttggtctgaatttccatccaggtggaagaaacact |
115 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43376649 |
aagaagtgacgggtgtctgtgtggtgg---gccatagcattgcctatccgttattgctgatgaacttggtctgaatttccatccaggtggaagaaacact |
43376553 |
T |
 |
| Q |
116 |
catcagatcaaactctgatcagaaccactttcaacttc-------------ccaaacatgtccacacaactagaaaacgcgttggtagaaatccaaatcc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43376552 |
catcagatcaaactctgatcagaaccactttcaacttcccaatttatcttcccaaacatgtccacacaactagaaaacgcgttggtagaaatccaaatcc |
43376453 |
T |
 |
| Q |
203 |
ccgaacaaaagctt |
216 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43376452 |
ccgaacaaaagctt |
43376439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University