View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8870_low_14 (Length: 216)
Name: NF8870_low_14
Description: NF8870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8870_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 32679715 - 32679640
Alignment:
| Q |
1 |
ggttttcatcctttgtgggttgtacctgacttctaaaccttttcatcctttatggttgtacctgacttctaaacct |
76 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32679715 |
ggttttcatcctttatgggttgtacctgacttctaaaccttttcatcctttatggttgtacctgacttctaaacct |
32679640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 3 - 50
Target Start/End: Complemental strand, 32679676 - 32679630
Alignment:
| Q |
3 |
ttttcatcctttgtgggttgtacctgacttctaaaccttttcatcctt |
50 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32679676 |
ttttcatcctttatgg-ttgtacctgacttctaaaccttttcatcctt |
32679630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 5e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 42 - 121
Target Start/End: Original strand, 2230576 - 2230655
Alignment:
| Q |
42 |
ttcatcctttatggttgtacctgacttctaaacctatcaccggaggccttaagttttttcatatccacatattattattc |
121 |
Q |
| |
|
|||||||||| || ||||||||| |||||||||| |||||| ||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
2230576 |
ttcatcctttttgattgtacctggcttctaaaccaatcaccagaggccttaagtttttttatatccatatattattattc |
2230655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 197
Target Start/End: Original strand, 2230704 - 2230756
Alignment:
| Q |
145 |
ttttgttttgctccttaatcttaggtcttttattacttgggcgagctgaatga |
197 |
Q |
| |
|
|||| ||| ||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2230704 |
ttttttttcgctcctttatcttaggtctttaattacttgggcgagctgaatga |
2230756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 123 - 197
Target Start/End: Original strand, 44806913 - 44806987
Alignment:
| Q |
123 |
tggtttgtgttttggcatctgattttgttttgctccttaatcttaggtcttttattacttgggcgagctgaatga |
197 |
Q |
| |
|
|||||||| |||| | |||||||||| || ||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44806913 |
tggtttgtattttagtatctgatttttcttcgctcctttatcttaggtcttttattacttgggcgagttgaatga |
44806987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 41 - 108
Target Start/End: Original strand, 44806806 - 44806873
Alignment:
| Q |
41 |
tttcatcctttatggttgtacctgacttctaaacctatcaccggaggccttaagttttttcatatcca |
108 |
Q |
| |
|
|||||| |||| || ||||||| | |||||||||| |||||| |||| |||||||||||||||||||| |
|
|
| T |
44806806 |
tttcattctttttgattgtacccggcttctaaaccaatcaccagaggacttaagttttttcatatcca |
44806873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 41 - 121
Target Start/End: Complemental strand, 28136035 - 28135955
Alignment:
| Q |
41 |
tttcatcctttatggttgtacctgacttctaaacctatcaccggaggccttaagttttttcatatccacatattattattc |
121 |
Q |
| |
|
||||||||||| | ||||||| | |||||||||| |||||| ||| ||||| |||||||||||||| |||||||||||| |
|
|
| T |
28136035 |
tttcatccttttttattgtacccggcttctaaaccaatcaccagagtccttatgttttttcatatccctatattattattc |
28135955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 123 - 197
Target Start/End: Complemental strand, 28135930 - 28135855
Alignment:
| Q |
123 |
tggtttgtgttttggc-atctgattttgttttgctccttaatcttaggtcttttattacttgggcgagctgaatga |
197 |
Q |
| |
|
||||||||||||| | |||| ||||| ||| ||||||| ||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
28135930 |
tggtttgtgtttttactatctaattttttttcgctcctttatcttaggtattttattacttgggtgagctgaatga |
28135855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University