View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8871_high_6 (Length: 296)

Name: NF8871_high_6
Description: NF8871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8871_high_6
NF8871_high_6
[»] chr4 (2 HSPs)
chr4 (14-114)||(29075222-29075321)
chr4 (196-281)||(29075412-29075497)


Alignment Details
Target: chr4 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 14 - 114
Target Start/End: Original strand, 29075222 - 29075321
Alignment:
14 agatagattcgtgttttacgaaaaaatctaagggtagttttgtgaacaatcaaaaattgccaacaaacattgatgctgtcggagttaataagattccaca 113  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||    
29075222 agatagattcgtgttttacgaaaa-atctaagggtagttttgtgaacaacaaaaaattgccaacaaacattgatgctgtcggagttaataagattccaca 29075320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 196 - 281
Target Start/End: Original strand, 29075412 - 29075497
Alignment:
196 ctacgttgctaagtagtattataaaatccatagtttttgacnnnnnnnnnngtccatatagtttcatattaatgtcttcatattac 281  Q
    |||||||||||||||||||||||||||||||||||||||||          |||||||| ||||||||||||||||||||||||||    
29075412 ctacgttgctaagtagtattataaaatccatagtttttgacaaaaaaaaaagtccatattgtttcatattaatgtcttcatattac 29075497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University