View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8871_low_11 (Length: 284)
Name: NF8871_low_11
Description: NF8871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8871_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 110 - 263
Target Start/End: Complemental strand, 52824640 - 52824485
Alignment:
| Q |
110 |
gatatgatagtttgatgatgtgaaaagaagagtgctagagagaaaatcagatgttgaatgaatgtatgaaatctaaagatatgtctatatcattgttgat |
209 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824640 |
gatatgacagtttgatgatgtgaaaagaagagtgctagagagaaaatcagatgttgaatgaatgtatgaaatctaaagatatgtctatatcattgttgat |
52824541 |
T |
 |
| Q |
210 |
atata--tataataagatgtgacaatgttaattgggagggattgttatctgtggaa |
263 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824540 |
atatatatataataagatgtgacaatgttaattgggagggattgttatctgtggaa |
52824485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 52824759 - 52824696
Alignment:
| Q |
1 |
aaacaaaatattcatactagagctacatcaacgttttgtgtaca-ccctgtagtgtatacatct |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52824759 |
aaacaaaatattcatactagagctacatcaacgttttgtgtacacccctgtagtgtatacatct |
52824696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University