View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8871_low_11 (Length: 284)

Name: NF8871_low_11
Description: NF8871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8871_low_11
NF8871_low_11
[»] chr3 (2 HSPs)
chr3 (110-263)||(52824485-52824640)
chr3 (1-63)||(52824696-52824759)


Alignment Details
Target: chr3 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 110 - 263
Target Start/End: Complemental strand, 52824640 - 52824485
Alignment:
110 gatatgatagtttgatgatgtgaaaagaagagtgctagagagaaaatcagatgttgaatgaatgtatgaaatctaaagatatgtctatatcattgttgat 209  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52824640 gatatgacagtttgatgatgtgaaaagaagagtgctagagagaaaatcagatgttgaatgaatgtatgaaatctaaagatatgtctatatcattgttgat 52824541  T
210 atata--tataataagatgtgacaatgttaattgggagggattgttatctgtggaa 263  Q
    |||||  |||||||||||||||||||||||||||||||||||||||||||||||||    
52824540 atatatatataataagatgtgacaatgttaattgggagggattgttatctgtggaa 52824485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 52824759 - 52824696
Alignment:
1 aaacaaaatattcatactagagctacatcaacgttttgtgtaca-ccctgtagtgtatacatct 63  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
52824759 aaacaaaatattcatactagagctacatcaacgttttgtgtacacccctgtagtgtatacatct 52824696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University